Understanding the Mechanism of Frameshift Mutation With Examples

The most common disease caused by this type of mutation is cystic fibrosis, a condition where the normal production of bodily fluids is severely hampered.

To understand the magnitude of impact of frameshift mutations, one must first acquaint themselves with the central dogma of molecular biology. It is described as the unilateral flow of genetic information from DNA to RNA to protein.

It involves the transcription of DNA into RNA molecules, which are then translated into proteins via the protein synthesizing machinery of the cell.

In this process, the DNA sequence is read by the RNA producing machinery, which yields an mRNA template, that is the blueprint of the future protein. This mRNA molecule interacts with an rRNA molecule, and binds to a ribosome, where it is processed.

In the ribosome, the genetic code is read in the codons, and the corresponding anti-codon of the tRNA helps in building the amino acid base of the protein. Each codon (triplet of nucleotides) codes for a particular amino acid, and this process is carried out till a stop codon or a terminating sequence is reached.

Thereafter, the long strand of amino acids undergo post-transnational modification, and fold to form a functional protein.

✶ The reason why these types of mutations have very grave consequences is that, the sequence of amino acid codons change drastically after the point of mutation, leading to a disruption of the entire original amino acid sequence, unless another mutation restores the shifted frame to its original orientation.

╬  A codon is nothing but a set of three immediate successive nucleotides along the DNA or RNA strand.

Each codon consists of a variation of the letters U (uridine), A (adenine), C (cytosine), and G (guanine), and the juxtaposition of these molecules into sets of three represents codons that are particular for certain amino acids. Some of these codons also function to signal chain initiation or termination.

For example, the codon AUG corresponds to methionine amino acid, and also signifies the initiation of the amino acid chain; the codon GCU refers to alanine; and the codons UAG or UAA are identified as stop codons, that terminate the chain, and conclude the translation of RNA to protein sequence.

╬  Codons are not only vital in the conversion of RNA to protein, but in the formation of RNA as well, since the transcription machinery identifies the DNA template and then reads the DNA nucleotides in consecutive sets of three.

The frame of recognition is called the reading frame, and is determined when RNA transcription begins. It is regulated by the promoter and initiating sequence of the gene to be transcribed.

The reading frame of codons is subject to three cardinal rules, which are:

• Codons are read in the 5' to 3' direction.
• Codons are non-overlapping, and there are no gaps between them.
• The reading frame is fixed; that is, it will only read three nucleotides at any given time.

These mutations may arise due to genetic or environmental factors. They may also be a result of errors in transcription. All these factors result in either the insertion or deletion of nucleotides, which lead to a shift in the reading frame.

╬ Environmental Factors:

• Exposure to UV light
• Exposure to nuclear radiation
• Ingestion of toxic chemicals

╬ Genetic Factors:

• Point mutations
• Strand slippage during transcription
• Incorrect DNA repair

All these factors ultimately, lead to either the insertion or deletion of nucleotides in the sequence. However, it must be noted that, these lead to frameshift mutations only if the total number of inserted or deleted nucleotides is not a multiple of three. This is because, if the number is a multiple of three, the shift in the reading frame is likely to return to its original form over the course of the sequence. This is possible due to the fact that the frame recognizes triplets.

Lets us consider a sequence of nucleotides and observe how an insertion event affects it. Therefore, let the original sequence be considered as,

AUGGAGCACGAUCUAUCAGUUACGGACGCAUAA

If this sequence is arranged as codons, the sequence appears as,

AUG GAG CAC GAU CUA UCA GUU ACG GAC GCA UAA

Now, in the event of an insertion event, a nucleotide (G) gets inserted after the fifth codon, the new sequence would be read as

AUG GAG CAC GAU CUA GUC AGU UAC GGA CGC AUA A

As you can see, the reading frame has shifted, and hence, the corresponding amino acids would also change, giving rise to a defunct or nonsensical protein.

If the original codon sequence is,

AUG GAG CAC GAU CUA UCA GUU ACG GAC GCA UAA

In a deletion event, if the nucleotide in the third codon is deleted, the resultant codon sequence would be,

AUG GAG C•CG AUC UAU CAG UUA CGG ACG CAU AA

The • represents the deleted nucleotide (A).

● Hereditary Breast Cancer
● MALT Lymphoma
● Crohn's Disease
● Cystic Fibrosis
● Tay-Sachs Disease
● Smith-Magenis Syndrome
● Hypertrophic Cardiomyopathy

Finding a cure for disorders resulting from frameshift mutations is extremely rare. This is supported by substantial research in this field.

However, one can try to manage the condition by gene therapy or immunotherapy. The reason for their incurable nature is that, the shifting of the frame compounds the effect of the minor mutation, and compromises the function and integrity of the protein to be produced.

This in turn also leads to the aggregation of several mutations in the genome due to faulty cellular machinery. This accumulation of mutations, after it reaches a critical limit, give rise to various health disorders. The sheer magnitude of the damage to the genome makes it nearly impossible to correct with the current technological options available.